Online citations, reference lists, and bibliographies.
Please confirm you are human
(Sign Up for free to never see this)
← Back to Search

Structure And Functional Binding Epitope Of V-domain Ig Suppressor Of T-cell Activation (VISTA)

Nishant Mehta, Sainiteesh Maddineni, I. Mathews, Andres Parra Sperberg, Po-Ssu Huang, J. Cochran
Published 2019 · Chemistry, Biology

Save to my Library
Download PDF
Analyze on Scholarcy
Share
V-domain Ig Suppressor of T cell Activation (VISTA) is an immune checkpoint protein that inhibits the T - cell response against cancer. Similar to PD-1 and CTLA-4, antibodies that block VISTA signaling can release the brakes of the immune system and promote tumor clearance. VISTA has an Ig-like fold, but little is known about its structure and mechanism of action. Here, we report a 1.85 Å crystal structure of the human VISTA extracellular domain and highlight structural features that make VISTA unique among B7 family members. Through fine-epitope mapping, we also identify solvent-exposed residues that underlie binding to a clinically relevant anti-VISTA antibody. This antibody-binding region is also shown to interact with V-set and Ig domain-containing 3 (VSIG3), the recently proposed functional binding partner of VISTA. The structure and functional epitope determined here will help guide future drug development efforts against this important checkpoint target.
This paper references
10.4049/jimmunol.1402648
Mechanistic Assessment of PD-1H Coinhibitory Receptor–Induced T Cell Tolerance to Allogeneic Antigens
D. Flies (2015)
a mechanism of acquired resistance to anti-PD-1 therapy in metastatic melanoma patients
Kakavand (2017)
10.1158/0008-5472.CAN-13-1504
VISTA is an immune checkpoint molecule for human T cells.
J. L. Lines (2014)
Therapeutic role of the novel checkpoint regulator VISTA in murine autoimmune disease models. (P5174)
S. Ceeraz (2013)
10.1016/S0022-1759(98)00158-6
A yeast surface display system for the discovery of ligands that trigger cell activation.
B. K. Cho (1998)
10.1016/j.jbiotec.2017.08.023
Construction of a versatile expression library for all human single-pass transmembrane proteins for receptor pairings by high throughput screening.
W. Yang (2017)
10.1038/s41598-017-08414-y
Structure-based cross-docking analysis of antibody–antigen interactions
K. P. Kilambi (2017)
10.1084/jem.20100619
VISTA, a novel mouse Ig superfamily ligand that negatively regulates T cell responses
L. Wang (2011)
10.1038/modpathol.2017.89
Negative immune checkpoint regulation by VISTA: a mechanism of acquired resistance to anti-PD-1 therapy in metastatic melanoma patients
H. Kakavand (2017)
10.1107/97809553602060000865
Phenix - a comprehensive python-based system for macromolecular structure solution
P. Adams (2012)
10.1016/J.JMB.2004.07.053
Fine epitope mapping of anti-epidermal growth factor receptor antibodies through random mutagenesis and yeast surface display.
Ginger Chao (2004)
10.1107/S0021889807021206
Phaser crystallographic software
A. McCoy (2007)
10.1158/0008-5472.CAN-13-1506
VISTA Regulates the Development of Protective Antitumor Immunity.
I. Le Mercier (2014)
10.1007/978-1-62703-992-5_10
Yeast surface display for antibody isolation: library construction, library screening, and affinity maturation.
James A Van Deventer (2014)
Monoclonal antibodies : methods and protocols
M. Albitar (2007)
10.1158/1078-0432.CCR-12-2063
Antagonist Antibodies to PD-1 and B7-H1 (PD-L1) in the Treatment of Advanced Human Cancer
M. Sznol (2013)
10.1073/pnas.1420370112
Immune-checkpoint proteins VISTA and PD-1 nonredundantly regulate murine T-cell responses
J. Liu (2015)
Anti vista antibodies and fragments
スナイダー,リンダ (2014)
10.1038/nprot.2016.180
Modeling and docking of antibody structures with Rosetta
Brian D Weitzner (2017)
10.1172/JCI74589
Coinhibitory receptor PD-1H preferentially suppresses CD4⁺ T cell-mediated immunity.
D. Flies (2014)
10.1038/nm.4308
VISTA is an inhibitory immune checkpoint that is increased after ipilimumab therapy in patients with prostate cancer
Jianjun Gao (2017)
10.1016/S0092-8674(02)00963-7
Crystal Structure of the Complex of Human Epidermal Growth Factor and Receptor Extracellular Domains
H. Ogiso (2002)
10.1007/978-1-4939-6634-9_5
Computer-Aided Drug Design Methods.
W. Yu (2017)
10.1093/nar/gkw357
Dali server update
L. Holm (2016)
10.1007/s00262-018-2227-8
Expression of the inhibitory B7 family molecule VISTA in human colorectal carcinoma tumors
S. Xie (2018)
10.1016/J.YMETH.2004.03.030
Lipidic cubic phases as matrices for membrane protein crystallization.
P. Nollert (2004)
10.1097/MPA.0000000000000949
The Role of 68Ga-DOTATATE Positron Emission Tomography/Computed Tomography in Well-Differentiated Neuroendocrine Tumors: A Case-Based Approach Illustrates Potential Benefits and Challenges.
N. Raj (2018)
10.1016/S0076-6879(00)28410-3
Yeast surface display for directed evolution of protein expression, affinity, and stability.
E. Boder (2000)
10.1080/2162402X.2018.1469594
VISTA is highly expressed on MDSCs and mediates an inhibition of T cell response in patients with AML
L. Wang (2018)
10.1016/S0076-6879(04)88027-3
Engineering antibody affinity by yeast surface display.
David W. Colby (2004)
Two-Stage PCR Protocol Allowing Introduction of Multiple Mutations , Deletions and Insertions Using QuikChange Site-Directed Mutagenesis
R GCGACCGAGTTGCTCTTGCCCC (1999)
10.1111/imm.13001
VSIG‐3 as a ligand of VISTA inhibits human T‐cell function
J. Wang (2019)
10.1038/nprot.2006.94
Isolating and engineering human antibodies using yeast surface display
Ginger Chao (2006)
10.1107/S0907444997011980
Miscellaneous algorithms for density modification.
K. Cowtan (1998)
10.1007/s13238-010-0022-1
A dimeric structure of PD-L1: functional units or evolutionary relics?
Y. Chen (2010)
10.1038/NBT0697-553
Yeast surface display for screening combinatorial polypeptide libraries
E. Boder (1997)
10.1016/j.str.2013.08.005
High-resolution comparative modeling with RosettaCM.
Y. Song (2013)
10.1016/J.JMB.2007.01.011
The crystal structure of the extracellular domain of the inhibitor receptor expressed on myeloid cells IREM-1.
J. A. Márquez (2007)
10.1186/gb-2005-6-6-223
The B7 family of immune-regulatory ligands
M. Collins (2005)
10.1097/MPA.0000000000001059
High-Density Infiltration of V-domain Immunoglobulin Suppressor of T-cell Activation Up-regulated Immune Cells in Human Pancreatic Cancer
Jinʼe Liu (2018)
10.1158/1078-0432.CCR-17-2542
Spatially Resolved and Quantitative Analysis of VISTA/PD-1H as a Novel Immunotherapy Target in Human Non–Small Cell Lung Cancer
F. Villarroel‐Espíndola (2017)
10.1016/j.str.2016.06.026
Structure and Dynamics of PD-L1 and an Ultra-High-Affinity PD-1 Receptor Mutant.
R. Pascolutti (2016)
10.1038/s41416-018-0313-5
VISTA expressed in tumour cells regulates T cell function
Kumuluzi Mulati (2018)
10.2144/99264ST03
Two-stage PCR protocol allowing introduction of multiple mutations, deletions and insertions using QuikChange Site-Directed Mutagenesis.
W. Wang (1999)



This paper is referenced by
Semantic Scholar Logo Some data provided by SemanticScholar