Online citations, reference lists, and bibliographies.

Huanglongbing, A Systemic Disease, Restructures The Bacterial Community Associated With Citrus Roots

Pankaj K. Trivedi, Yongping Duan, Nian Wang
Published 2010 · Medicine, Biology
Cite This
Download PDF
Analyze on Scholarcy
Share
ABSTRACT To examine the effect of pathogens on the diversity and structure of plant-associated bacterial communities, we carried out a molecular analysis using citrus and huanglongbing as a host-disease model. 16S rRNA gene clone library analysis of citrus roots revealed shifts in microbial diversity in response to pathogen infection. The clone library of the uninfected root samples has a majority of phylotypes showing similarity to well-known plant growth-promoting bacteria, including Caulobacter, Burkholderia, Lysobacter, Pantoea, Pseudomonas, Stenotrophomonas, Bacillus, and Paenibacillus. Infection by “Candidatus Liberibacter asiaticus” restructured the native microbial community associated with citrus roots and led to the loss of detection of most phylotypes while promoting the growth of bacteria such as Methylobacterium and Sphingobacterium. In pairwise comparisons, the clone library from uninfected roots contained significantly higher 16S rRNA gene diversity, as reflected in the higher Chao 1 richness estimation (P ≤ 0.01) of 237.13 versus 42.14 for the uninfected and infected clone libraries, respectively. Similarly, the Shannon index of the uninfected clone library (4.46) was significantly higher than that of the infected clone library (2.61). Comparison of the uninfected clone library with the infected clone library using LIBSHUFF statistics showed a significant difference (P ≤ 0.05). Quantitative PCR analysis revealed that the bacterial community changes not only qualitatively but also quantitatively. The relative proportions of different groups of bacteria changed significantly after infection with the pathogen. These data indicate that infection of citrus by “Ca. Liberibacter asiaticus” has a profound effect on the structure and composition of the bacterial community associated with citrus roots.
This paper references
10.1128/AEM.68.5.2261-2268.2002
Response of Endophytic Bacterial Communities in Potato Plants to Infection with Erwinia carotovora subsp. atroseptica
B. Reiter (2002)
10.1186/1471-2105-7-371
UniFrac – An online tool for comparing microbial community diversity in a phylogenetic context
C. Lozupone (2006)
10.1007/3-540-33526-9
Microbial Root Endophytes
B. Schulz (2006)
10.1038/nrm1984
Bacterial elicitation and evasion of plant innate immunity
R. B. Abramovitch (2006)
Microbial diversity in soil: selection of microbial populations by plant and soil type and impli- cations for disease
P. Garbeva (2004)
Plant-associated bacteria - lifestyle and molecular interactions
J. Sørensen (2007)
10.5860/choice.42-0682
Encyclopedia of plant and crop science
R. M. Goodman (2004)
10.1128/AEM.67.10.4414-4425.2001
Changes in Populations of Rhizosphere Bacteria Associated with Take-All Disease of Wheat
Brian B. McSpadden Gardener (2001)
10.1093/nar/gkl889
The ribosomal database project (RDP-II): introducing myRDP space and quality controlled public data
J. Cole (2007)
10.1007/s00248-007-9287-1
Endophytic Bacterial Diversity in Rice (Oryza sativa L.) Roots Estimated by 16S rDNA Sequence Analysis
L. Sun (2007)
10.1111/j.1574-6976.2001.tb00571.x
The species concept for prokaryotes.
R. Rosselló-Mora (2001)
10.1128/AEM.71.7.4117-4120.2005
Assessment of Soil Microbial Community Structure by Use of Taxon-Specific Quantitative PCR Assays
N. Fierer (2005)
10.1201/9781420015201
Modern soil microbiology
J. D. Elsas (2007)
10.1890/02-0298
GRASSROOTS ECOLOGY: PLANT–MICROBE–SOIL INTERACTIONS AS DRIVERS OF PLANT COMMUNITY STRUCTURE AND DYNAMICS
H. Reynolds (2003)
10.1111/j.1749-6632.1998.tb08993.x
The stress concept in plants: an introduction.
H. Lichtenthaler (1998)
High Bacterial Diversity in Permanently Cold Marine Sediments
GAATTCCACTTTCCCCTCTG (1999)
10.1007/3-540-33526-9_1
What are Endophytes
B. Schulz (2006)
HUANGLONGBING: A DESTRUCTIVE, NEWLY-EMERGING, CENTURY-OLD DISEASE OF CITRUS 1
A. D. Barros (2006)
10.1128/AEM.68.5.2198-2208.2002
Isolation and Characterization of Endophytic Colonizing Bacteria from Agronomic Crops and Prairie Plants
D. Zinniel (2002)
10.1128/AEM.71.9.4951-4959.2005
Use of Plant Growth-Promoting Bacteria for Biocontrol of Plant Diseases: Principles, Mechanisms of Action, and Future Prospects
S. Compant (2005)
10.1128/AEM.69.12.7310-7318.2003
Seasonal Changes in the Rhizosphere Microbial Communities Associated with Field-Grown Genetically Modified Canola (Brassica napus)
K. Dunfield (2003)
10.1146/annurev.arplant.57.032905.105159
The role of root exudates in rhizosphere interactions with plants and other organisms.
H. Bais (2006)
10.1111/j.1574-6941.2007.00428.x
Differences in vegetation composition and plant species identity lead to only minor changes in soil-borne microbial communities in a former arable field.
A. Kielak (2008)
10.1038/nature05286
The plant immune system
J. Jones (2006)
10.1007/s10658-009-9439-x
Quantification of viable Candidatus Liberibacter asiaticus in hosts using quantitative PCR with the aid of ethidium monoazide (EMA)
Pankaj K. Trivedi (2009)
10.1128/AEM.67.9.4374-4376.2001
Quantitative Comparisons of 16S rRNA Gene Sequence Libraries from Environmental Samples
D. Singleton (2001)
10.1007/BF02183056
Soil microbial diversity and the sustainability of agricultural soils
A. C. Kennedy (2004)
10.1146/annurev.micro.62.081307.162918
Plant-growth-promoting rhizobacteria.
B. Lugtenberg (2009)
10.1146/annurev.phyto.43.113004.133839
Plant disease: a threat to global food security.
R. Strange (2005)
10.1094/PHYTO-99-1-0050
Response of sweet orange (Citrus sinensis) to 'Candidatus Liberibacter asiaticus' infection: microscopy and microarray analyses.
Jeong-soon Kim (2009)
10.1081/E-EPCS-120010565
Classification and Nomenclature of Plant Pathogenic Bacteria
John M. Young (2004)
10.1111/ejss.4_12398
Microbial diversity and soil functions
P. Nannipieri (2003)
10.1146/annurev.phyto.42.012604.135455
Microbial diversity in soil: selection microbial populations by plant and soil type and implications for disease suppressiveness.
P. Garbeva (2004)
10.1111/j.1574-6941.2000.tb00717.x
Use of the T-RFLP technique to assess spatial and temporal changes in the bacterial community structure within an agricultural soil planted with transgenic and non-transgenic potato plants.
Lukow1 (2000)
10.1016/j.tim.2008.07.008
Properties of bacterial endophytes and their proposed role in plant growth.
P. Hardoim (2008)
10.1007/s002480000021
Variation of Microbial Rhizosphere Communities in Response to Crop Species, Soil Origin, and Inoculation with Sinorhizobium meliloti L33
R. Miethling (2000)
10.1073/pnas.142680199
Estimating prokaryotic diversity and its limits
T. Curtis (2002)
10.1146/annurev.phyto.43.040204.135923
Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens.
J. Glazebrook (2005)
10.1094/MPMI-22-8-1011
Complete genome sequence of citrus huanglongbing bacterium, 'Candidatus Liberibacter asiaticus' obtained through metagenomics.
Yongping Duan (2009)
aRarefactWin. University of Georgia, Athens, GA. http: //www.uga.edu/strata/software/anRareReadme.html
S. Holland (1998)
10.1094/PHYTO-98-5-0592
In planta distribution of 'Candidatus Liberibacter asiaticus' as revealed by polymerase chain reaction (PCR) and real-time PCR.
Satyanarayana Tatineni (2008)
10.1371/journal.pone.0002702
Native Bacterial Endophytes Promote Host Growth in a Species-Specific Manner; Phytohormone Manipulations Do Not Result in Common Growth Responses
Hoang Hoa Long (2008)
10.1128/AEM.02404-08
Bacterial Diversity Analysis of Huanglongbing Pathogen-Infected Citrus, Using PhyloChip Arrays and 16S rRNA Gene Clone Library Sequencing
Uma Shankar Sagaram (2009)
10.1186/1471-2105-7-57
FastGroupII: A web-based bioinformatics platform for analyses of large 16S rDNA libraries
Y. Yu (2005)
10.1007/PL00006783
Isolation of DNA from the Uncultured “Candidatus Liberobacter” Species Associated with Citrus Huanglongbing by RAPD
A. Hocquellet (1999)
10.1007/s002480000087
The Diversity of Archaea and Bacteria in Association with the Roots of Zea mays L.
M. Chelius (2001)
10.1094/MPMI-19-0827
Bacterial endophytes and their interactions with hosts.
M. Rosenblueth (2006)
10.1016/S0735-2689(01)80001-0
Bacterial Endophytes: Potential Role in Developing Sustainable Systems of Crop Production
A. V. Sturz (2000)
10.1111/J.1574-6968.2007.00918.X
Bacterial endophytes: recent developments and applications.
R. Ryan (2008)
10.1111/j.1574-6941.2001.tb00796.x
16S rDNA fingerprinting of rhizosphere bacterial communities associated with healthy and Phytophthora infected avocado roots.
Ching-Hong Yang (2001)
10.1111/j.1365-3059.2006.01438.x
Development and application of molecular-based diagnosis for ' Candidatus Liberibacter asiaticus', the causal pathogen of citrus huanglongbing
Zhongkang Wang (2006)
10.1111/j.1365-2672.2007.03709.x
The degradation of the herbicide bromoxynil and its impact on bacterial diversity in a top soil.
Joanne Baxter (2008)
10.1111/j.1574-6968.1999.tb13405.x
Biocontrol of plant disease: a (gram-) positive perspective.
E. Emmert (1999)
10.1128/aem.57.8.2171-2178.1991
Effects of fungal root pathogens on the population dynamics of biocontrol strains of fluorescent pseudomonads in the wheat rhizosphere.
M. Mazzola (1991)
10.1128/AEM.68.10.4906-4914.2002
Diversity of Endophytic Bacterial Populations and Their Interaction with Xylella fastidiosa in Citrus Plants
W. L. Araújo (2002)



This paper is referenced by
10.1128/AEM.00051-11
Restructuring of Endophytic Bacterial Communities in Grapevine Yellows-Diseased and Recovered Vitis vinifera L. Plants
D. Bulgari (2011)
10.1371/journal.pone.0111455
Influence of Soil Type, Cultivar and Verticillium dahliae on the Structure of the Root and Rhizosphere Soil Fungal Microbiome of Strawberry
Srivathsa Nallanchakravarthula (2014)
10.1038/srep37376
Differential fecal microbiota are retained in broiler chicken lines divergently selected for fatness traits
Q. Hou (2016)
10.1186/s40064-016-1780-x
Rhizospheric bacteria of maize with potential for biocontrol of Fusarium verticillioides
Alejandro Miguel Figueroa-López (2016)
10.1186/1471-2180-14-198
Endophytic bacterial community of grapevine leaves influenced by sampling date and phytoplasma infection process
D. Bulgari (2013)
Spatial Distribution of Root-Associated Microbial Communities
D. Minz (2013)
10.1038/s41598-019-50540-2
Deciphering bacterial and fungal endophyte communities in leaves of two maple trees with green islands
Franziska Wemheuer (2019)
10.1002/9781118297674.CH70
Understanding Root–Microbiome Interactions
Gaston Zolla (2013)
10.1089/ind.2018.29132.pzo
Quantifying Crop Rhizosphere Microbiome Ecology: The Next Frontier in Enhancing the Commercial Utility of Agricultural Microbes
Paul Zorner (2018)
10.1007/978-981-13-2832-9_10
Microbe Relationships with Phytoplasmas in Plants and Insects
Elena Gonella (2019)
10.1007/s11240-016-0999-0
Dynamics of endophytic bacteria in plant in vitro culture: quantification of three bacterial strains in Prunus avium in different plant organs and in vitro culture phases
Mona Quambusch (2016)
10.1016/j.chemosphere.2019.125242
Bacterial succession in oil-contaminated soil under phytoremediation with poplars.
Eglantina Lopez-Echartea (2020)
10.1007/s00284-015-0774-1
Internal Extracellular Bacteria of Diaphorina citri Kuwayama (Hemiptera: Psyllidae), the Asian Citrus Psyllid
Lakshmi Divya Kolora (2015)
10.1002/prot.24147
The ABC transporters in Candidatus Liberibacter asiaticus
W. Li (2012)
Correlating Citrus Tree Health with Microbes
Philippe E. Rolshausen (2018)
10.1016/S2095-3119(18)61918-5
Distribution pattern and titer of Candidatus Liberibacter asiaticus in periwinkle (Catharanthus roseus)
Ya Li (2018)
10.11606/T.64.2010.TDE-22062011-110739
Diversidade bacteriana endofítica associada à Citrus sinensis (L.) Osbeck com sintomas de Greening
Fernanda de Sousa Bernardes (2010)
10.1007/s00284-018-1485-1
Differential Modulation of Endophytic Microbiome of Ginger in the Presence of Beneficial Organisms, Pathogens and Both as Identified by DGGE Analysis
Rohini Sabu (2018)
10.3389/fmicb.2017.02415
Characterization of Antimicrobial-Producing Beneficial Bacteria Isolated from Huanglongbing Escape Citrus Trees
N. Riera (2017)
Isolation of potential biocontrol agents of 'Candidatus Phytoplasma mali'
Daniela Bulgari (2013)
10.1128/AEM.00210-17
Defining the Core Citrus Leaf- and Root-Associated Microbiota: Factors Associated with Community Structure and Implications for Managing Huanglongbing (Citrus Greening) Disease
Ryan Andrew Blaustein (2017)
10.1007/s12223-015-0378-y
Detection of novel Chlamydiae and Legionellales from human nasal samples of healthy volunteers
D. Corsaro (2015)
10.1016/J.SCIENTA.2014.07.041
Diverse DNA extraction methods and PCR primers for detection of Huanglongbing-associated bacteria from roots of ‘Valencia’ sweet orange on sour orange rootstock
Madhurababu Kunta (2014)
10.1094/PHYTO-12-16-0426-RVW
Tale of the Huanglongbing Disease Pyramid in the Context of the Citrus Microbiome.
Nian Wang (2017)
10.1186/s40064-015-1037-0
Endophytic bacterial diversity in the phyllosphere of Amazon Paullinia cupana associated with asymptomatic and symptomatic anthracnose
A. C. Bogas (2015)
Bactérias endofíticas e epifíticas cultivadas e não cultivadas do guaranazeiro e o controle da antracnose
Escola Superior de Agricultura (2012)
10.1016/j.micres.2017.02.001
Competition assays revealed Paenibacillus pasadenensis strain R16 as a novel antifungal agent.
Alessandro Passera (2017)
10.1094/PBIOMES-08-17-0032-A
Bacterial and Fungal Next Generation Sequencing Datasets and Metadata from Citrus Infected with ‘Candidatus Liberibacter asiaticus’
Nichole A. Ginnan (2018)
PLANT DISEASES ASSOCIATED WITH ‘ Candidatus LIBERIBACTER ’ SPECIES : CITRUS HUANLONGBING AND POTATO ZEBRA CHIP
E. Civerolo (2010)
10.1371/journal.pone.0195746
Zinc is an inhibitor of the LdtR transcriptional activator
Fernando A Pagliai (2018)
10.1007/s00248-018-1302-1
Penicillin Trunk Injection Affects Bacterial Community Structure in Citrus Trees
Marina S Ascunce (2018)
10.1186/s40168-017-0304-4
Huanglongbing impairs the rhizosphere-to-rhizoplane enrichment process of the citrus root-associated microbiome
Yunzeng Zhang (2017)
See more
Semantic Scholar Logo Some data provided by SemanticScholar